Designing An Experimental Scheme Assignment | Homework For You

TASK 1:

You need to devise a cloning scheme to solve the following problem. An insert is available and it contains a gene within it, whose exact position and orientation within the insert are unknown. This gene contains a sequence for an important small peptide hormone. No DNA sequence information is available. The insert is shown below with a strategic restriction site indicated. The specific task to be set out as an experimental strategy is as follows:

CLICK HERE TO PLACE AN ORDER

You have accepted a consultancy contract to provide a large amount of the purified peptide to a new medical centre that needs the peptide to treat patients. It is a new peptide on a DNA fragment just isolated and provided to you and is therefore not yet in commercial production. Of course it would be a simple task to sequence the insert and go from there, but for the purpose of this hypothetical exercise sequencing is unavailable.

Set up an experimental scheme that takes into account the task described above, beginning with the insert and the expression vector pUC18. A map of pUC18 with all features indicated, including the multi-cloning site, may be easily obtained by typing the vector name into Google.

The insert containing the peptide gene is a blunt-ended fragment of 1.8 kb that was not generated with a restriction enzyme. A single unique restriction site is indicated on the fragment. The size of the gene is unknown, but what is known is: (a) the orientation, which is right to left in the drawing below; (b) the gene does not have a promoter; and (c) there is a 6x His tag at the C-terminus of the Open Reading Frame (ORF).

TASK 2:

A gene, named LmrA, has been cloned into pUC18. It is aligned directionally with the 5-prime and 3-prime ends of the gene ligated into the BamHI and EcoRI sites of pUC18 (see the figure below). The sites precede and follow the ORF, but with extra sites in between (see the Figure below). In a subsequent cut-and-paste exercise, all of the extra sites were deleted so that LmrA is now abutted precisely with the preceding BamHI and tailing EcoRI sites, respectively. At the 5-prime end, the sequence begins GGATCCATG; and at the 3-prime end, the sequence concludes TAAGAATTC. The underlined bases are the start (ATG) and stop (TAA) codons for the gene. The other six bases are the BamHI and EcoRI sites at either end of the ORF.

The researcher who has this clone wants to run a series of experiments that will identify the expressed protein in Western blots, for which an antibody is required to identify the specific protein in a gel lane containing many proteins from a cell lysate. One simple way of achieving identification, and at some later stage, purification of the protein, is to have a specific monoclonal antibody to identify the protein. However, no such antibody is available, but a common practice in these circumstances is to insert an epitope at one end of the gene so that a specific antibody to the epitope will enable the identification and purification tasks.

CLICK HERE TO PLACE AN ORDER

Such an antibody is one that recognizes a hexameric histidine sequence (6x) attached to either the N- or C-terminus of the ORF of the cloned gene. The 6x His codon sequence (CAT.CAT.CAT.CAT.CAT.CAT) will have to be attached to LmrA at either the N- or C-terminal end. The cloning/attachment scheme may be performed using PCR and appropriate forward and reverse overlapped primers and an appropriate restriction site. An example of this type of scheme is relatively easy to set up, using either of the sequences given in the first paragraph above.

Set out your scheme for the attachment of the 6x histidine sequence to the (front) N-terminal end of LmrA within the recombinant plasmid. To do this, you will need a longer sequence than the one given in paragraph 1, that is, with a few extra codons added to the ATG start codon so that the primers will be long enough and overlap for the PCR. The sequence of the top strand should therefore include: GGATCCATGGAAAGAGGTCCACAA, where the first six codons of LmrA are underlined. Don’t forge the 6x histidine tag (CATCATCATCATCATCAT) needs to be incorporated in the new clone sequence AND correctly! Get Biology homework help today